Quick Order

Rat LAYN natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat LAYN cDNA Clone Product Information
Gene_bank_ref_id:NM_001191997.1
RefSeq ORF Size:1131bp
cDNA Description:Full length Clone DNA of Rattus norvegicus layilin.
Gene Synonym:RGD1564444, Layn
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Layilin, a recently characterized as a 55 kDa transmembrane protein with homology to C-type lectins, is present in numerous cell lines and tissue extracts. As one of the adaptor proteins, talin mediates the interactions between the actin filaments and the cell membrane by binding to integral membrane proteins and to the cytoskeleton. Layilin is a newly identified membrane-binding site for talin in peripheral ruffles of spreading cells, a ten-amino acid motif in the layilin cytoplasmic domain is sufficient for talin binding, and its adjacent LH2-LH3 tandem arrays in the cytoplasmic domain provide docking sites for talin. Furthermore, talin binds layilin, PIPK1gamma and integrins in similar although subtly different ways. Layilin binds specifically to hyaluronan (HA) through its extracellular domain, a ubiquitous extracellular matrix component in most animal tissues and body fluids, but not to other tested glycosaminoglycans. The research suggests that layilin may mediate signals from extracellular matrix to the cell cytoskeleton via interaction with different intracellular binding partners and thereby be involved in the modulation of cortical structures in the cell. All the above actions reveal an interesting parallel between layilin and the known HA receptor CD44. In addition, merlin and radixin have been identified as different intracellular binding partners of layilin. Accordingly, it has been suggested that layilin plays roles in a variety of cellular processes, including cell shape, adhesion, motility, and homeostasis, as well as signal transduction. In addition, layilin might play an important role in the process of invasion and lymphatic metastasis of lung carcinoma.

References
  • Borowsky ML, et al. (1998) Layilin, a novel talin-binding transmembrane protein homologous with C-type lectins, is localized in membrane ruffles.J Cell Biol. 143(2):429-42.
  • Bono P, et al. (2001) Layilin, a novel integral membrane protein, is a hyaluronan receptor. Mol Biol Cell. 12(4)891-900.
  • Bono P, et al. (2005) Layilin, a cell surface hyaluronan receptor, interacts with merlin and radixin. Exp Cell Res. 308(1):177-87.
  • Scoles DR. (2007) The merlin interacting proteins reveal multiple targets for NF2 therapy. Biochim Biophys Acta. 1785(1):32-54.
  • Chen Z, et al. (2008) Down-regulation of layilin, a novel hyaluronan receptor, via RNA interference, inhibits invasion and lymphatic metastasis of human lung A549 cells. Biotechnol Appl Biochem. 50(Pt 2):89-96.
  • Wegener KL, et al. (2008) Structural basis for the interaction between the cytoplasmic domain of the hyaluronate receptor layilin and the talin F3 subdomain. J Mol Biol. 382(1):112-26.
  • Size / Price
    Catalog: RG80431-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"