Quick Order

Text Size:AAA

Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SRCcDNA Clone Product Information
Gene_bank_ref_id:NM_005417.3
cDNA Size:1650
cDNA Description:ORF Clone of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) DNA.
Gene Synonym:ASV, SRC1, c-SRC, p60-Src, SRC
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:HindIII + XbaI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1218G>C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10755-ACG$345
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10755-ACR$345
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10755-ANG$345
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10755-ANR$345
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10755-CF$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10755-CH$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10755-CM$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10755-CY$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone)HG10755-M$115
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10755-M-F$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10755-NF$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10755-NH$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10755-NM$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10755-NY$315
Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10755-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

References
  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catalog:HG10755-NF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Human SRC Kinase / Proto-oncogene c-Src Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"