Quick Order

Rat IL20 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat IL20 cDNA Clone Product Information
Gene_bank_ref_id:NM_001143881.1
RefSeq ORF Size:531bp
cDNA Description:Full length Clone DNA of Rattus norvegicus interleukin 20.
Gene Synonym:Il20
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

IL20/Interleukin-20 belongs to the IL-10 family. It is a cytokine structurally related to interleukin 10. IL20/Interleukin-20 can be detected in skin, trachea, and other tissues. It is produced by activated keratinocytes and monocytes and transmits an intracellular signal through two distinct cell-surface receptor complexes on keratinocytes and other epithelial cells.It has been shown that interleukin-20 transduce its signal through signal transducer and activator of transcription 3 (STAT3) in keratinocytes. It may be involved in epidermal function and psoriasis. It also regulates proliferation and differentiation of keratinocytes during inflammation, particularly inflammation associated with the skin. In addition, IL20/Interleukin-20 also causes cell expansion of multipotential hematopoietic progenitor cells. A specific receptor for this cytokine is found to be expressed in skin and upregulated dramatically in psoriatic skin, suggesting a role for this protein in epidermal function and psoriasis.

References
  • Chen XY, et al. (2011) The association between the IL-20-1723CG allele on the 1q chromosome and psoriasis triggered or exacerbated by an upper respiratory tract infection in the Chinese Han population. Dermatology. 222(1):24-30.
  • Baird AM, et al. (2011) IL-20 is epigenetically regulated in NSCLC and down regulates the expression of VEGF. Eur J Cancer. 47(12):1908-18.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Size / Price
    Catalog: RG80422-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"