Quick Order

Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPK9cDNA Clone Product Information
Gene_bank_ref_id:NM_002752.4
cDNA Size:1275
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase 9 DNA.
Gene Synonym:JNK2, SAPK, p54a, JNK2A, JNK2B, PRKM9, JNK-55, JNK2BETA, p54aSAPK, JNK2ALPHA, MAPK9
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10745-ACG$325
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10745-ACR$325
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10745-ANG$325
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10745-ANR$325
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10745-CF$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10745-CH$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10745-CM$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10745-CY$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone)HG10745-M$95
Human JNK2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10745-M-F$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10745-M-N$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10745-NF$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10745-NH$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10745-NM$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10745-NY$295
Human JNK2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10745-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Mitogen-activated protein kinase 9 (MAPK9), also well known as c-Jun N-terminal kinase (JNK2), is a member of MAP kinase subfamily belonging to the protein kinase superfamily. MAPK9 responds to activation by environmental stress and pro-inflammatory cytokines by phosphorylating a number of transcription factors, such as c-Jun and ATF2. The crystal structure of human JNK2 complexed with an indazole inhibitor by applying a high-throughput protein engineering and surface-site mutagenesis approach. A novel conformation of the activation loop is observed, which is not compatible with its phosphorylation by upstream kinases. This activation inhibitory conformation of JNK2 is stabilized by the MAP kinase insert that interacts with the activation loop in an induced-fit manner. It suggest that the MAP kinase insert of JNK2 plays a role in the regulation of JNK2 activation, possibly by interacting with intracellular binding partners. JNK2 deficiency leads to reduced c-Jun degradation, thereby augmenting c-Jun levels and cellular proliferation, and suggests that JNK2 is a negative regulator of cellular proliferation in multiple cell types. JNK2 prevents replicative stress by coordinating cell cycle progression and DNA damage repair mechanisms. JNK2 blocks the ubiquitination of tumor suppressor p53, and thus increases the stability of p53 in nonstressed cells. JNK2 negatively regulates antigen-specific CD8+ T cell expansion and effector function, and thus selectively blocking JNK2 in CD8+ T cells may potentially enhance anti-tumor immune response. Lack of JNK2 expression was associated with higher tumor aneuploidy and reduced DNA damage response. Additionally,the JNK2 protein could be a novel therapeutic target in dry eye disease, and may provide a novel target for prevention of vascular disease and atherosclerosis.

References
  • Sabapathy K, et al. (2004) JNK2: a negative regulator of cellular proliferation. Cell Cycle. 3(12): 1520-3.
  • Tao J, et al. (2007) JNK2 negatively regulates CD8+ T cell effector function and anti-tumor immune response. Eur J Immunol. 37(3): 818-29.
  • Shaw D, et al. (2008) The crystal structure of JNK2 reveals conformational flexibility in the MAP kinase insert and indicates its involvement in the regulation of catalytic activity. J Mol Biol. 383(4): 885-93.
  • Osto E, et al. (2008) c-Jun N-terminal kinase 2 deficiency protects against hypercholesterolemia-induced endothelial dysfunction and oxidative stress. 118(20): 2073-80.
  • De Paiva CS, et al. (2009) Essential role for c-Jun N-terminal kinase 2 in corneal epithelial response to desiccating stress. Arch Ophthalmol. 127(12): 1625-31.
  • Chen P, et al. (2010) Jnk2 effects on tumor development, genetic instability and replicative stress in an oncogene-driven mouse mammary tumor model. PLoS One. 5(5): e10443.
  • Size / Price
    Catalog:HG10745-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"