After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat NCAM1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat NCAM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_031521.1
RefSeq ORF Size:2577bp
cDNA Description:Full length Clone DNA of Rattus norvegicus neural cell adhesion molecule 1.
Gene Synonym:Cd56, Ncam, N-CAM, NCAMC, NCAM-1, NCAM-C, N-CAM-1, MGC124601, Ncam1
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

References
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    Catalog: RG80399-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"