After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat LGALS3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat LGALS3 cDNA Clone Product Information
Gene_bank_ref_id:NM_031832.1
RefSeq ORF Size:789bp
cDNA Description:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 3.
Gene Synonym:gal-3, MGC105387, Lgals3
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Size / Price
    Catalog: RG80393-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"