Quick Order

Rat ICOS natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat ICOS cDNA Clone Product Information
Gene_bank_ref_id:NM_022610.1
RefSeq ORF Size:603bp
cDNA Description:Full length Clone DNA of Rattus norvegicus inducible T-cell co-stimulator.
Gene Synonym:Ailim, Icos
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

References
  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.
  • Size / Price
    Catalog: RG80381-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"