Quick Order

Text Size:AAA

Rat PDGFRB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PDGFRB cDNA Clone Product Information
Gene_bank_ref_id:NM_031525.1
RefSeq ORF Size:3294bp
cDNA Description:Full length Clone DNA of Rattus norvegicus platelet derived growth factor receptor, beta polypeptide.
Gene Synonym:Pdgfrb
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD140b, also known as PDGFRB, is a member of the CD system. CD140b is a cell surface tyrosine kinase receptor essencial for development interacting with the platelet-derived growth factors (PDGFs) which serves as mitogens for mesenchymal cells. CD140b can bind with platelet-derived growth factor (PDGF)-B, that are secreted by tumors and phosphorylation of PDGFR-β was correlated with depth of cancer invasion at statistically significant level.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Suzuki S, et al. (2010) Clinicopathological significance of platelet-derived growth factor (PDGF)-B and vascular endothelial growth factor-A expression, PDGF receptor- phosphorylation, and microvessel density in gastric cancer. BMC cancer. 10: 659.
  • Size / Price
    Catalog: RG80347-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"