After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat MPL natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat MPL cDNA Clone Product Information
Gene_bank_ref_id:XM_345572.5
RefSeq ORF Size:1935bp
cDNA Description:Full length Clone DNA of Rattus norvegicus myeloproliferative leukemia virus oncogene.
Gene Synonym:Mpl
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Catalog: RG80346-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"