After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD82 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD82cDNA Clone Product Information
Gene_bank_ref_id:NM_031797.2
cDNA Size:801
cDNA Description:ORF Clone of Rattus norvegicus Cd82 molecule DNA.
Gene Synonym:Kai1, Cd82
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

References
  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • Size / Price
    Catalog:RG80332-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"