After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CD6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD6cDNA Clone Product Information
cDNA Size:1998
cDNA Description:ORF Clone of Rattus norvegicus Cd6 molecule DNA.
Gene Synonym:OX52, MGC108551, Cd6
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items