After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD68 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD68 cDNA Clone Product Information
Gene_bank_ref_id:NM_001031638.1
RefSeq ORF Size:993bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Cd68 molecule.
Gene Synonym:MGC114377, Cd68
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

References
  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Size / Price
    Catalog: RG80307-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"