Quick Order

Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HTRA2cDNA Clone Product Information
cDNA Size:1377
cDNA Description:ORF Clone of Homo sapiens HtrA serine peptidase 2 DNA.
Gene Synonym:OMI, PARK13, PRSS25
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10619-ACG$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10619-ACR$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10619-ANG$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10619-ANR$325
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10619-CF$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10619-CH$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10619-CM$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10619-CY$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone)HG10619-M$95
Human HTRA2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10619-M-F$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10619-M-N$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10619-NF$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10619-NH$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10619-NM$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10619-NY$295
Human HTRA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10619-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Serine protease HTRA2, also known as high temperature requirement protein A2, Omi stress-regulated endoprotease, Serine protease 25, Serine proteinase OMI and HTRA2, is a single-pass membrane protein which belongs to the peptidase S1B family. HTRA2 contains one PDZ (DHR) domain. HTRA2 is a serine protease that shows proteolytic activity against a non-specific substrate beta-casein. It promotes or induces cell death either by direct binding to and inhibition of BIRC proteins (also called inhibitor of apoptosis proteins, IAPs), leading to an increase in caspase activity, or by a BIRC inhibition-independent, caspase-independent and serine protease activity-dependent mechanism. HTRA2 cleaves THAP5 and promotes its degradation during apoptosis. Isoform 2 of HTRA2 seems to be proteolytically inactive. Defects in HTRA2 are the cause of Parkinson disease type 13 (PARK13) which is a complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability, as well as by a clinically significant response to treatment with levodopa.

  • Faccio L., et al., 2000, J. Biol. Chem. 275:2581-2588.
  • Gray C.W., et al., 2000, Eur. J. Biochem. 267:5699-5710.
  • Suzuki Y., et al., 2001, Mol. Cell 8:613-621.
  • Strauss K.M., et al., 2005, Hum. Mol. Genet. 14:2099-2111.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items