After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LOX-1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human OLR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002543.3
RefSeq ORF Size:822bp
cDNA Description:Full length Clone DNA of Homo sapiens oxidized low density lipoprotein (lectin-like) receptor 1 with N terminal Flag tag.
Gene Synonym:LOX1, CLEC8A, SCARE1
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-OLR1
Restriction Site:KpnI (two restriction sites) + XbaI (6kb + 0.81kb + 0.1kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions. 

References
  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.
  • Size / Price
    Catalog: HG10585-NF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"