Quick Order

Text Size:AAA

Human JAM-B Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
JAM2cDNA Clone Product Information
cDNA Size:897
cDNA Description:ORF Clone of Homo sapiens junctional adhesion molecule 2 DNA.
Gene Synonym:JAMB, CD322, JAM-B, VEJAM, PRO245, VE-JAM, C21orf43
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.