Quick Order

Rat CLEC5A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CLEC5A cDNA Clone Product Information
Gene_bank_ref_id:NM_001109377.1
RefSeq ORF Size:573bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A.
Gene Synonym:Clec5a
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

References
  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • Size / Price
    Catalog: RG80259-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"