After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human TPO R ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MPL cDNA Clone Product Information
NCBI RefSeq:NM_005373.2
RefSeq ORF Size:1908bp
cDNA Description:Full length Clone DNA of Homo sapiens myeloproliferative leukemia virus oncogene with N terminal Flag tag.
Gene Synonym:MPLV, TPOR, C-MPL, CD110, MPL
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-MPL
Restriction Site:KpnI (two restriction sites) + XbaI (6kb+1kb+0.93kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MPL Gene Plasmid Map
Human TPO R natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Catalog: HG10443-NF
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"