Quick Order

Text Size:AAA

Human CystatinE / CST6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CST6cDNA Clone Product Information
Gene_bank_ref_id:NM_001323.2
cDNA Size:450
cDNA Description:ORF Clone of Homo sapiens cystatin E/M DNA.
Gene Synonym:CST6
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CystatinE / CST6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name
Background

Cystatin E/M, also referred to as CST6, is a member of type 2 cysteine proteinase inhibitors of the cystatin superfamily, and inhibits papain and cathepsin B. Cystatin E is a low molecular mass secreted protein existing in both a glycosylated (17 kDa) and an unglycosylated (14 kDa) form, with two characteristic intrachain disulfide bridges. Expression of cystatin M/E is found to be restricted to the epidermis, more specifically in the stratum granulosum, sweat glands, sebaceous glands, and the hair follicles. In addition to its function as a cysteine protease inhibitor, cystatin M/E also serves as a target for cross-linking by transglutaminases. Accordingly, cystatin M/E was suggested to be involved in barrier formation and maintenance. Furthermore, studies have revealed that cystatin M/E is frequently epigenetically inactivated during breast carcinogenesis, and thus be regarded as a candidate of tumour suppressor gene.

Size / Price
Catalog:HG10438-NF
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"