After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Thyroid peroxidase / TPO Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPOcDNA Clone Product Information
cDNA Size:2802
cDNA Description:ORF Clone of Homo sapiens thyroid peroxidase DNA.
Gene Synonym:MSA, TPX, TDH2A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human Thyroid peroxidase / TPO Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Thyroid peroxidase is a membrane-bound glycoprotein which belongs to the peroxidase family, XPO subfamily. It contains 1 EGF-like domain and 1 Sushi (CCP/SCR) domain. Thyroid Peroxidase represents one of the main autoantigenic targets in autoimmune thyroid disease of humans. It used to be taken as the formerly so-called `microsomal antigen` several years ago. As an integral membrane glycoprotein it is restricted to the apical plasma membrane of the follicular epithelial cells and comprises two identical subunits of approx 100 kDa molecular weight. Thyroid peroxidase is an enzyme expressed abundantly in the thyroid that liberates iodine for addition onto tyrosine residues on thyroglobulin for the production of thyroxine or triiodothyronine, thyroid hormones. Thyroid peroxidase plays a key role in the thyroid hormone biosynthesis by catalysing both the iodination of tyrosyl residues and the coupling of iodotyrosyl residues in thyroglobulin to form precursors of the thyroid hormones T4 and T3.

  • McLachlan SM, et al. (2000) Autoimmune response to the thyroid in humans: thyroid peroxidase--the common autoantigenic denominator. Int Rev Immunol. 19(6):587-618.
  • Nagasaka A, et al. (1976) Effect of antithyroid agents 6-propyl-2-thiouracil and 1-mehtyl-2-mercaptoimidazole on human thyroid iodine peroxidase. J Clin Endocrinol Metab. 43(1): 152-8.
  • Kimura S, et al. (1987) Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs. Proc Natl Acad. 84(16):5555-9.
  • Ruf J, et al. (2006) Structural and functional aspects of thyroid peroxidase. Arch Biochem Biophys. 445 (2):269-77.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items