After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat VEGFB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VEGFBcDNA Clone Product Information
Gene_bank_ref_id:NM_053549.1
cDNA Size:561
cDNA Description:ORF Clone of Rattus norvegicus vascular endothelial growth factor B DNA.
Gene Synonym:Vegfb
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF-B / VEGFB Protein (Fc Tag)Human VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)
Size / Price
Catalog:RG80114-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"