Quick Order

Text Size:AAA

Human PHGDH Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PHGDHcDNA Clone Product Information
Gene_bank_ref_id:NM_006623.3
cDNA Size:1602
cDNA Description:ORF Clone of Homo sapiens phosphoglycerate dehydrogenase DNA.
Gene Synonym:PDG, PGD, PGAD, PGDH, SERA, 3PGDH, 3-PGDH, MGC3017, PHGDH
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

PHGDH is a member of the D-isomer specific 2-hydroxyacid dehydrogenase family. This new family consists of D-isomer-stereospecific enzymes. The conserved residues in this family appear to be the residues involved in the substrate binding and the catalytic reaction, and thus to be targets for site-directed mutagenesis. A number of NAD-dependent 2-hydroxyacid dehydrogenases which seem to be specific for the D-isomer of their substrate have been shown to be functionally and structurally related. PHGDH catalyzes the transition of 3-phosphoglycerate into 3-phosphohydroxypyruvate, which is the first and rate-limiting step in the phosphorylated pathway of serine biosynthesis, using NAD+/NADH as a cofactor. Overexpression of PHGDH may cause certain breast cancers. Defects in PHGDH are the cause of phosphoglycerate dehydrogenase deficiency which is characterized by congenital microcephaly, psychomotor retardation, and seizures.

References
  • Pind S, et al. (2002) V490M, a common mutation in 3-phosphoglycerate dehydrogenase deficiency, causes enzyme deficiency by decreasing the yield of mature enzyme. J Biol Chem. 277 (9): 7136-43.
  • Du H, et al. (2010) 3-Phosphoglycerate dehydrogenase expression is regulated by HOXA10 in murine endometrium and human endometrial cells. Reproduction. 139 (1): 237-45.
  • Possemato R, et al. (2011) Functional genomics reveal that the serine synthesis pathway is essential in breast cancer. Nature. 476 (7360): 346-50.
  • Size / Price
    Catalog:HG13167-CF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"