After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human PTPRJ Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PTPRJcDNA Clone Product Information
Gene Bank Ref.ID:NM_002843.3
cDNA Size:4014
cDNA Description:ORF Clone of Homo sapiens protein tyrosine phosphatase, receptor type, J DNA.
Gene Synonym:DEP1, SCC1, CD148, HPTPeta, R-PTP-ETA, PTPRJ
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

DEP1 / PTPRJ (Receptor-type tyrosine-protein phosphatase eta) is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. DEP1 / PTPRJ possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. DEP1 / PTPRJ is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. In stable MCF-7 cell lines lines, induction of DEP-1 expression inhibited breast cancer cell growth by 5-10-fold. These data describe PTPs expressed and regulated in breast cancer cell lines during differentiation and identify one PTP, DEP-1, that inhibits the growth of breast cancer cells in vitro.

  • Holsinger LJ, et al. (2002) The transmembrane receptor protein tyrosine phosphatase DEP1 interacts with p120. Oncogene. 21(46): 7067-76.
  • Huang X, et al. (2009) Natural variation at the DEP1 locus enhances grain yield in rice. Nat Genet. 41(4): 494-7.
  • Kuramochi S, et al. (1996) Molecular cloning and characterization of Byp, a murine receptor-type tyrosine phosphatase similar to human DEP-1. FEBS Lett. 378(1): 7-14.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availsability:2-3 weeks