Quick Order

Rat CD4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD4cDNA Clone Product Information
cDNA Size:1374
cDNA Description:ORF Clone of Rattus norvegicus Cd4 molecule DNA.
Gene Synonym:p55, W3/25, Cd4
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

T-cell surface glycoprotein CD4,  is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

Viral protein U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4.

  • Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.
  • Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.
  • Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items