After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CCL27 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat CCL27 cDNA Clone Product Information
NCBI RefSeq:NM_001108660.1
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 27.
Gene Synonym:Ccl27
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

CCL27, also known as CTACK, is a small cytokine belonging to the CC chemokine family. Members of this family are proteins characterized by two adjacent cysteines. CCL27 is chemotactic for skin-associated memory T lymphocytes. CCL27 may also play a role in mediating homing of lymphocytes to cutaneous sites. CCL27 plays a pivotal role in establishing the inflammatory infiltrate characteristic for common inflammatory skin diseases. Through binding to the chemokine receptor 10 (CCR10), CCL27 mediates inflammation by promoting lymphocyte migration into the skin.

References
  • Morales. et al., 1999, Proc Natl Acad Sci. 96: 14470-5.
  • Homey. et al., 2002, J Immunol. 164: 3465-70.
  • Ishikawa-Mochizuki. et al., 1999, FEBS Lett. 460: 544-8.
  • Size / Price
    Catalog: RG80085-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"