Quick Order

Rat WFDC2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat WFDC2 cDNA Clone Product Information
Gene_bank_ref_id:NM_173109.1
RefSeq ORF Size:363bp
cDNA Description:Full length Clone DNA of Rattus norvegicus WAP four-disulfide core domain 2.
Gene Synonym:re4, Wfdc2
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

References
  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellström,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.
  • Size / Price
    Catalog: RG80084-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"