Quick Order

Text Size:AAA

Rat IL23A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL23AcDNA Clone Product Information
Gene_bank_ref_id:NM_130410.2
cDNA Size:591
cDNA Description:ORF Clone of Rattus norvegicus Interleukin 23, alpha subunit p19 DNA.
Gene Synonym:MGC114275, Il23a
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
IL-12 Family & Receptor Related Products
Product nameProduct name
Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12B / P40 Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL27 / Interleukin-27 Protein (His Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12RB1 / IL12RB / CD212 Protein (His Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL12B / IL-12B Protein (Fc Tag)Mouse IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinCynomolgus / Rhesus IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL27 / Interleukin-27 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Cynomolgus / Rhesus IL12A / NKSF1 Protein (Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag) Cynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Marmoset IL12B / IL-12B Protein (Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL12A & IL27B Heterodimer Protein
Size / Price
Catalog:RG80080-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"