After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat TEK / Tie2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TEKcDNA Clone Product Information
cDNA Size:3363
cDNA Description:ORF Clone of Rattus norvegicus TEK tyrosine kinase, endothelial DNA.
Gene Synonym:Tie2, Tie-2, Tek
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Angiopoietin/Tie Related Products

TEK, or TIE-2, is an endothelial cell-specific receptor tyrosine kinase (RTK) that is known as a functioning molecule of vascular endothelial cells. TEK comprises a subfamily of RTK with TIE, and these two receptors play critical roles in vascular maturation, maintenance of integrity and remodeling. Targeted mutagenesis of both Tek and its agonistic ligand, Angiopoietin-1, result in embryonic lethality, demonstrating that the signal transduction pathways mediated by this receptor are crucial for normal embryonic development. TEK signaling is indispensable for the development of the embryonic vasculature and suggests that TEK signaling may also be required for the development of the tumor vasculature.

  • Jones N, et al. (1998) The Tek / Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene. 17(9): 1097-108.
  • Sato A, et al. (1998) Characterization of TEK receptor tyrosine kinase and its ligands, Angiopoietins, in human hematopoietic progenitor cells. Int Immunol. 10(8): 1217-27.
  • Huang L, et al. (1995) GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK / TIE2 receptor tyrosine kinase. Oncogene. 11(10): 2097-103.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks