Quick Order

Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SHHcDNA Clone Product Information
Gene_bank_ref_id:NM_000193.2
cDNA Size:1389
cDNA Description:ORF Clone of Homo sapiens sonic hedgehog homolog (Drosophila) DNA.
Gene Synonym:TPT, HHG1, HLP3, HPE3, SMMCI, TPTPS, MCOPCB5, SHH
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10372-ACG$325
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10372-ACR$325
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10372-CF$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10372-CH$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10372-CM$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10372-CY$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone)HG10372-M$95
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10372-M-F$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, HA-taggedHG10372-M-Y$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10372-NF$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10372-NH$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10372-NM$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10372-NY$295
Human SHH / Sonic Hedgehog Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10372-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Sonic HedgeHog, also known as sonic hedgehog protein, belongs to the hedgehog family. It cannot be detected in adult tissues while can be found in fetal intestine, liver, lung, and kidney. Sonic HedgeHog is a protein that is vital in guding the early embryo. It has been associated as the major inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Sonic HedgeHog intercellular signal is essential for a various patterning events during development: signal produced by the notochord that induces ventral cell fate in the neural tube and somites, and the polarizing signal for patterning of the anterior-posterior axis of the developing limb bud. Sonic HedgeHog binds to the patched receptor, which functions in association with smoothened, to activate the transcription of target genes. In the absence of sonic HedgeHog, patched receptor represses the constitutive signaling activity of smoothened. Sonic HedgeHog also regulates another factor, the gli oncogene. Defects in sonic hedgehog can cause microphthalmia isolated with coloboma type 5, triphalangeal thumb-polysyndactyly syndrome and holoprosencephaly type 3.

References
  • Ericson J, et al. (1997) Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol. 62:451-66.
  • Marigo V, et al. (1996) Regulation of patched by sonic hedgehog in the developing neural tube. Proc Natl Acad Sci. 93(18):9346-51.
  • Stone DM, et al. (1996) he tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 384:129-34.
  • Size / Price
    Catalog:HG10372-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"