After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CXCL6 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CXCL5 cDNA Clone Product Information
Gene_bank_ref_id:NM_022214.1
RefSeq ORF Size:393bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-X-C motif) ligand 6.
Gene Synonym:Cxcl5
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL5 is produced following stimulation of cells with the inflammatory cytokines interleukin-1 or tumor necrosis factor-alpha. It also can be detected in eosinophils, and can be inhibited with the type II interferon. CXCL5 plays a role in reducing sensitivity to sunburn pain in some subjects, and is a potential target which can be utilized to understand more about pain in other inflammatory conditions like arthritis and cystitis. It stimulates the chemotaxis of neutrophils possesses angiogenic properties. It elicits these effects by interacting with the cell surface chemokine receptor CXCR2.

References
  • Dawes JM, et al. (2011) CXCL5 Mediates UVB Irradiation-Induced Pain. Sci Transl Med. 3(90): 90ra60.
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Persson T, et al. (2003) Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy. 33(4):531-7.
  • Size / Price
    Catalog: RG80059-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"