After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat CCL3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CCL3 cDNA Clone Product Information
NCBI RefSeq:NM_013025.2
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 3.
Gene Synonym:Scya3, MIP-1a, Ccl3
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

CCL3 is a cytokine belonging to the CC chemokine family. Chemokines are a family of structurally related leukocyte chemoattractant cytokines that play a central role during immunoregulatory and inflammation processes. All chemokines contain four conserved cysteines linked by disulfide bonds, and two major subfamilies, namely CXC and CC, are defined on the basis of the first two cysteines which are separated by one amino acid or are adjacent. CCL3 is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes.

References
  • Zhao RY, et al. (2005) Viral infections and cell cycle G2/M regulation. Cell Res. 15(3):143-9. Joseph AM, et al. (2005) Nef: "necessary and enforcing factor" in HIV infection. Curr HIV Res. 3(1):87-94. Muthumani K, et al. (2004) HIV-1 Vpr and anti-inflammatory activity. DNA Cell Biol. 23(4): 239-47.
  • Size / Price
    Catalog: RG80044-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"