Quick Order

Human MTSS1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MTSS1 cDNA Clone Product Information
Gene_bank_ref_id:NM_014751.4
RefSeq ORF Size:2268bp
cDNA Description:Full length Clone DNA of Homo sapiens metastasis suppressor 1 with C terminal Flag tag.
Gene Synonym:MIM, MIMA, MIMB, FLJ44694, KIAA0429, DKFZp781P2223, MTSS1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

MTSS1 (Metastasis suppressor 1), also known as Missing in metastasis (MIM), is a tissue-specific regulator of plasma membrane dynamics. MTSS1 is well described for its function as a metastasis suppressor gene and is expressed in a variety of tissues. MTSS1 might be involved in shaping neuronal membranes in vivo. MTSS1 deforms phosphoinositide-rich membranes through its I-BAR domain and interacts with actin monomers through its WH2 domain. MTSS1/MIM was first identified as a metastasis suppressor missing in metastatic bladder carcinoma cell lines. MTSS1 is a prognostic indicator of disease-free survival in breast cancer patients and demonstrates the ability to play a role in governing the metastatic nature of breast cancer cells. MTSS1 may serve as a useful biomarker for the prediction of outcome of gastric cancer. The down-regulation of MTSS1 that may be caused by DNA methylation was also observed in many other types of cancer.Recent work proposed that MIM also potentiates Sonic hedgehog (Shh)-induced gene expression. MTSS1 as a multiple functional molecular player and has an important role in development, carcinogenesis and metastasis.

References
  • Hayn-Leichsenring G, et al. (2011) Cellular distribution of metastasis suppressor 1 and the shape of cell bodies are temporarily altered in Engrailed-2 overexpressing cerebellar Purkinje cells. Neuroscience. 189: 68-78.
  • Xie F, et al. (2011) MTSS1: a multifunctional protein and its role in cancer invasion and metastasis. Front Biosci (Schol Ed). 3: 621-31.
  • Saarikangas J, et al. (2011) Missing-in-metastasis MIM/MTSS1 promotes actin assembly at intercellular junctions and is required for integrity of kidney epithelia. J Cell Sci. 2124(Pt 8): 1245-55.
  • Parr C, et al. (2009) Metastasis suppressor 1 (MTSS1) demonstrates prognostic value and anti-metastatic properties in breast cancer. Eur J Cancer. 45(9): 1673-83.
  • Size / Price
    Catalog: HG13085-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"