Quick Order

Text Size:AAA

Rat CystatinC / CST3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CST3 cDNA Clone Product Information
Gene_bank_ref_id:NM_012837.1
RefSeq ORF Size:423bp
cDNA Description:Full length Clone DNA of Rattus norvegicus cystatin C.
Gene Synonym:CYSC, MGC105556, Cst3
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Cystatin C, also known as Cystatin-3 (CST3) is a secreted type 2 cysteine protease inhibitor synthesized in all nucleated cells, has been proposed as a replacement for serum creatinine for the assessment of renal function, particularly to detect small reductions in glomerular filtration rate. The mature, active form of human cystatin C is a single non-glycosylated polypeptide chain consisting of 120 amino acid residues, with a molecular mass of 13,343-13,359 Da, and containing four characteristic disulfide-paired cysteine residues. Cystatin C is a low-molecular-weight protein which has been proposed as a marker of renal function that could replace creatinine. Indeed, the concentration of Cystatin C is mainly determined by glomerular filtration and is particularly of interest in clinical settings where the relationship between creatinine production and muscle mass impairs the clinical performance of creatinine. Since the last decade, numerous studies have evaluated its potential use in measuring renal function in various populations. More recently, other potential developments for its clinical use have emerged. In almost all the clinical studies, Cystatin C demonstrated a better diagnostic accuracy than serum creatinine in discriminating normal from impaired kidney function, but controversial results have been obtained by comparing this protein with other indices of kidney disease, especially serum creatinine-based equations, such as early atherosclerosis, Alzheimer's dementia, vascular aneurysms, hyperhomocysteinaemia and other neurodegenerative diseases. Cystatin C could be a useful clinical tool to identify HIV-infected persons. In addition, its expression is up-regulated in malignance of certain tumor progression.

References
  • Mares J, et al. (2003) Use of cystatin C determination in clinical diagnostics. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 147(2): 177-80.
  • Mussap M, et al. (2004) Biochemistry and clinical role of human cystatin C. Crit Rev Clin Lab Sci. 41(5-6): 467-550.
  • Sronie-Vivien S, et al. (2008) Cystatin C: current position and future prospects. Clin Chem Lab Med. 46(12): 1664-86.
  • Taglieri N, et al. (2009) Cystatin C and cardiovascular risk. Clin Chem. 55(11): 1932-43.
  • Size / Price
    Catalog: RG80040-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"