Quick Order

Text Size:AAA

Human PGA4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGA4cDNA Clone Product Information
Gene_bank_ref_id:NM_001079808.1
cDNA Size:1206
cDNA Description:ORF Clone of Homo sapiens pepsinogen 4, group I (pepsinogen A) DNA.
Gene Synonym:PGA3, PGA5, FLJ58952, FLJ77962, PGA4
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:KpnI + XbaI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

PGA4 (Pepsinogen 4, group I), or Pepsinogen A, is a member of the peptidase A1 family. Pepsin is expressed as a pro-form zymogen, pepsinogen, whose primary structure has an additional 44 amino acids. Pepsin is stored as pepsinogen so it will only be released when needed, and does not digest the body's own proteins in the stomach's lining. Five types of zymogens of pepsins, gastric digestive proteinases, are known: pepsinogens A, B, and F, progastricsin, and prochymosin. There are two major groups of pepsinogen, namely pepsinogen A (PGA) and pepsinogen C (PGC) (or progastricsin), and each frequently has isozymogens. The PGA3, PGA4 and PGA5 genes encode identical human pepsinogen A enzymes.

References
  • Kageyama T. (2002) Pepsinogens, progastricsins, and prochymosins: structure, function, evolution, and development. Cell Mol Life Sci. 59(2): 288-306.
  • Takahashi K. (1992) Gene structures of pepsinogens A and C. Scand J Clin Lab Invest Suppl. 210: 97-110.
  • Size / Price
    Catalog:HG13082-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human PGA4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"