Quick Order

Text Size:AAA

Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ICAM1cDNA Clone Product Information
cDNA Size:1605
cDNA Description:ORF Clone of Homo sapiens intercellular adhesion molecule 1 DNA.
Gene Synonym:BB2, CD54, P3.58
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10346-ACG$345
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10346-ACR$345
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10346-CF$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10346-CH$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10346-CM$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10346-CY$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone)HG10346-M$115
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10346-M-F$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10346-M-H$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10346-M-N$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10346-NF$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10346-NH$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10346-NM$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10346-NY$315
Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10346-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Intercellular adhesion molecule-1 (ICAM-1, or CD54) is a 90 kDa member of the immunoglobulin (Ig) superfamily and is critical for the firm arrest and transmigration of leukocytes out of blood vessels and into tissues. ICAM-1 is constitutively present on endothelial cells, but its expression is increased by proinflammatory cytokines. The endothelial expression of ICAM-1 is increased in atherosclerotic and transplant-associated atherosclerotic tissue and in animal models of atherosclerosis. Additionally, ICAM-1 has been implicated in the progression of autoimmune diseases. ICAM-1 is a ligand for LFA-1(integrin). When activated, leukocytes bind to endothelial cells via ICAM-1/LFA-1 interaction and then transmigrate into tissues. Presence with heavy glycosylation and other structural characteristics, ICAM-1 possesses binding sites for a number of immune-associated ligands and serves as the binding site for entry of the major group of human Rhinovirus (HRV) into various cell types. ICAM-1 also becomes known for its affinity for Plasmodium falciparum-infected erythrocytes (PFIE), providing more of a role in infectious disease. Previous studies have shown that ICAM-1 is involved in inflammatory reactions and that a defect in ICAM-1 gene inhibits allergic contact hypersensitivity.

  • Xu H, et al. (2001) The role of ICAM-1 molecule in the migration of Langerhans cells in the skin and regional lymph node. Eur J Immunol. 31(10): 3085-93.
  • Terol MJ, et al. (2003) Soluble intercellular adhesion molecule-1 (s-ICAM-1/s-CD54) in diffuse large B-cell lymphoma: association with clinical characteristics and outcome. Ann Oncol. 14(3): 467-74.
  • Mendez MP, et al. (2006) Shedding of soluble ICAM-1 into the alveolar space in murine models of acute lung injury. Am J Physiol Lung Cell Mol Physiol. 290(5): L962-70.
  • Lawson C, et al. (2009) ICAM-1 signaling in endothelial cells. Pharmacol Rep. 61(1): 22-32.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human ICAM-1 / CD54 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
    Recently Viewed Items