Quick Order

Text Size:AAA

Human SLITRK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLITRK1cDNA Clone Product Information
Gene_bank_ref_id:NM_052910.1
cDNA Size:2091
cDNA Description:ORF Clone of Homo sapiens SLIT and NTRK-like family, member 1 DNA.
Gene Synonym:LRRC12, FLJ54428, KIAA0918, KIAA1910, RP11-395N17.1
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.

References

1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

Size / Price
Catalog:HG10340-NF
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"