Quick Order

Text Size:AAA

Human ATP1B4 ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human ATP1B4 cDNA Clone Product Information
NCBI RefSeq:NM_001142447.2
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Homo sapiens ATPase, Na+/K+ transporting, beta 4 polypeptide with C terminal Flag tag.
Gene Synonym:ATP1B4
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ATP1B4 is a member of the X(+)/potassium ATPases subunit beta family. It is highly expressed in skeletal muscle and at a lower level in heart. ATP1B4 gene can be found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na, K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. ATP1B4 may act as a transcriptional coregulator during muscle development through its interaction with SNW1. Na+, K+-ATPase is an important regulator of intracellular electrolyte levels in most mammalian cells. It is a Mg2+-dependent transport pump responsible for maintaining the low intracellular Na+:K+ ratio that is essential for cell homeostasis and physiological function. It catalyzes the active uptake of K+ and extrusion of Na+ at the expense of hydrolyzing ATP with a stoichiometry of 3 Na+ for 2 K+. ATP1B4 has lost its ancestral function as a Na,K-ATPase beta-subunit.

References
  • Pestov NB. et al., 2007, Proc Natl Acad Sci. 104 (27): 11215-20.
  • Kung AW. et al., 2006, Clin Endocrinol. 64 (2): 158-61.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalog: HG13027-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"