Quick Order

Text Size:AAA

Rat CD89 / FCAR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat FCAR cDNA Clone Product Information
NCBI RefSeq:NM_201992.1
RefSeq ORF Size:843bp
cDNA Description:Full length Clone DNA of Rattus norvegicus IgA Fc receptor.
Gene Synonym:CD89, Fcar
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

FCAR, also called FcαRI or CD89, is a type I  transmembrane receptor for Fc region of IgA which is the most abundant immunoglobulin in mucosal areas but is only the second most common antibody isotype in serum. This receptor is present on the surface of myeloid lineage cells such as neutrophils, monocytes, macrophages, and eosinophils, especially phagocytes located in mucosal areas. Upon ligand IgA binding, FcαRI associates with the FcR γ signaling molecule bearing the immunoreceptor tyrosine-based activation motif (ITAM) through a unique charge-based mechanism and triggers multiple cell-mediated immune responses. It has been reported that Fc RI is a dual-function receptor that can mediate both inflammatory and anti-inflammatory responses depending on the type of interaction with its ligand. Sustained aggregation of FCAR results in activation of target-cell functions such as antigen presentation and cytokine release. In contrast, Monomeric targeting with serum IgA or with a variety of anti-FcαRI Fab fragments triggers an inhibitory response and additionally induces apoptosis. FcαRI thus play an fundamental role in preventing tumor development and growth, as well as in controlling inflammation.

References
  1. Maliszewski, C.R. et al., 1990, J. Exp. Med. 172: 1665-1672.
  2. Launay, P. et al., 1999, J. Biol. Chem. 274: 7216-7225.
  3. Monteiro, R.C. et al., 2003, Annu. Rev. Immunol. 21: 177-204.
  4. Otten, M.A. et al., 2005, J. Immunol. 174: 5472-5480.
  5. Pasquier, B. et al., 2005, Immunity. 22:31-42.
  6. Kanamaru, Y. et al., 2007, Blood. 109: 203-211.
Size / Price
Catalog: RG80014-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"