Quick Order

Text Size:AAA

Rat DLL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DLL1cDNA Clone Product Information
Gene_bank_ref_id:NM_032063.1
cDNA Size:2145
cDNA Description:ORF Clone of Rattus norvegicus delta-like 1 (Drosophila) DNA.
Gene Synonym:Dll1
Species:Rat
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Delta-like protein 1(DLL1), also known as Delta1, a single-pass type I membrane protein which contains one DSL domain and eight EGF-like domains,  acts as a ligand for Notch receptors, and positively regulates T-cell development. DLL1 is proteolytically processed in a similar manner to the Notch receptor, and it has been speculated to participate in bidirectional signaling. The proteolytic processing of DLL1 helps achieve an asymmetry in Notch signaling in initially equivalent myogenic cells and helps sustain the balance between differentiation and self-renewal. Interactions between DLL1 and Notch in trans activate the Notch pathway, whereas DLL1 binding to Notch in cis inhibits Notch signaling. DLL1 undergoes proteolytic processing in its extracellular domain by ADAM10. It had been demonstrated that DLL1 represents a substrate for several other members of the ADAM family. In co-transfected cells, DLL1 is constitutively cleaved by ADAM12, and the N-terminal fragment of DLL1 is released to medium. ADAM12-mediated cleavage of DLL1 is cell density-dependent, takes place in cis orientation, and does not require the presence of the cytoplasmic domain of ADAM12. Full-length DLL1, but not its N- or C-terminal proteolytic fragment, co-immunoprecipitates with ADAM12. By using a Notch reporter construct, we show that DLL1 processing by ADAM12 increases Notch signaling in a cell-autonomous manner. Furthermore, ADAM9 and ADAM17 have the ability to process DLL1. In contrast, ADAM15 does not cleave DLL1, although the two proteins still co-immunoprecipitate with each other. During fetal development, DLL1 is an essential Notch ligand in the vascular endothelium of large arteries to activate Notch1 and maintain arterial identity. DLL1-Notch signaling was required for VEGF receptor expression in fetal arteries.

References
  • Dyczynska E, et al. (2007) Proteolytic processing of delta-like 1 by ADAM proteases. J Biol Chem. 282(1): 436-44.
  • Sun D, et al. (2008) The role of Delta-like 1 shedding in muscle cell self-renewal and differentiation. J Cell Sci. 121(Pt 22): 3815-23.
  • Srensen I, et al. (2009) DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood. 113(22): 5680-8.
  • Size / Price
    Catalog:RG80013-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"