After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human HAPLN1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAPLN1cDNA Clone Product Information
cDNA Size:1065
cDNA Description:ORF Clone of Homo sapiens hyaluronan and proteoglycan link protein 1 DNA.
Gene Synonym:CRTL1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Hyaluronan (HA) is a high MW glycosaminoglycan significantly involved in the formation and stability of extracellular matrix via its association with specific HA-binding proteins. HAPLN1, also known as CRTL1 (Cartilage Link Protein 1, cLP ) and link protein, is a member of HA-binding protein (hyaladherins) family, and contains a common structural domain of about 100 amino acids that is termed a Link module with two α-helices and two antiparallel β-sheets. HAPLN1/CRTL1 stabilizes the interaction between hyaluronan (HA) and versican, two extracellular matrix components essential for cardiac development. Link module superfamily can be divided into three subgroups, and the HAPLN family are C domain-type proteins that have an extended structure with one N-terminal V-type Ig-like domain followed by two link modules. In cartilage, aggrecan forms - cLP stabilized aggregates with HA that provides the tissue with its load bearing properties. HAPLN1 is a component of follicular matrix, was shown to enhance cumulus-oocyte complex (COC) expansion in vitro. HAPLN1 may promote periovulatory granulosa cell survival, which would facilitate their differentiation into luteal cells.

  • Sun GW, et al. (2003) Follicle-stimulating hormone and insulin-like growth factor I synergistically induce up-regulation of cartilage link protein (Crtl1) via activation of phosphatidylinositol-dependent kinase/Akt in rat granulosa cells. Endocrinology. 144(3): 793-801.
  • Wirrig EE, et al. (2007) Cartilage link protein 1 (Crtl1), an extracellular matrix component playing an important role in heart development. Dev Biol. 310(2): 291-303.
  • Liu J, et al. (2010) Periovulatory expression of hyaluronan and proteoglycan link protein 1 (Hapln1) in the rat ovary: hormonal regulation and potential function. Mol Endocrinol. 24(6): 1203-17.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items