Quick Order

Human EZR ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EZR cDNA Clone Product Information
Gene_bank_ref_id:NM_001111077.1
RefSeq ORF Size:1761bp
cDNA Description:Full length Clone DNA of Homo sapiens ezrin with C terminal Flag tag.
Gene Synonym:CVL, CVIL, VIL2, HEL-S-105
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

VIL2, also known as villin-2, belongs to the ERM protein family. It is expressed in cerebral cortex, basal ganglia, hippocampus, hypophysis, and optic nerve. VIL2 contains 1 FERM domain and may be involved in connections of major cytoskeletal structures to the plasma membrane. It plays a key role in cell surface structure adhesion, migration, and organization. In epithelial cells, VIL2 is required for the formation of microvilli and membrane ruffles on the apical pole. It interacts with MPP5 and SLC9A3R2. It is found VIL2 form a complex with PODXL and SLC9A3R2. It also interacts with MCC, PLEKHG6, PODXL, SCYL3/PACE1, SLC9A3R1 and TMEM8B.

References
  • Grnholm M, et al. (1999) Homotypic and heterotypic interaction of the neurofibromatosis 2 tumor suppressor protein merlin and the ERM protein ezrin. J Cell Sci. 112(6):895-904.
  • Sitaraman, et al. (2002) The adenosine 2b receptor is recruited to the plasma membrane and associates with E3KARP and Ezrin upon agonist stimulation. J Biol Chem. 277(36):33188-95.
  • Gould KL, et al. (1989) cDNA cloning and sequencing of the protein-tyrosine kinase substrate, ezrin, reveals homology to band 4.1. EMBO J. 8(13):4133-42.
  • Size / Price
    Catalog: HG12858-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"