After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat GpT2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat GPT2 cDNA Clone Product Information
NCBI RefSeq:NM_001012057.1
RefSeq ORF Size:1569bp
cDNA Description:Full length Clone DNA of Rattus norvegicus glutamic pyruvate transaminase (alanine aminotransferase) 2.
Gene Synonym:ALT2, Cc2-5, Gpt2
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (Gpt), is a pyridoxal enzyme which catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. Gpt1 is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level, whereas Gpt2 expression is more restricted, mainly in liver, muscle, brain, and white adipose tissue. It has been reported that hepatic ALT2 protein is approximately four times higher in male rats than in female rats.

References
  • Matthews, C.C. et al., 2002, Genomics. 79: 445-450.
  • Jadhao, S.B. et al., 2004, Hepatology. 39: 1297-1302.
  • Schindhelm, R.K. et al., 2005, Eur. J.Clin. Invest. 35:369-374.
  • Lindblom, P. et al., 2007, Arch Biochem Biophys. 466 (1): 66-77.
  • Liu, L.et al., 2008, Protein Expr Purif. 60 (2): 225-231.
  • Yang, R. Z. et al., 2009, Hepatology. 49 (2): 598-607.
  • Size / Price
    Catalog: RG80002-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"