After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ROBO2 transcript variant 2 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ROBO2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002942.4
RefSeq ORF Size:4137bp
cDNA Description:Full length Clone DNA of Homo sapiens roundabout, axon guidance receptor, homolog 2 (Drosophila), transcript variant 2 with N terminal Flag tag.
Gene Synonym:SAX3, KIAA1568
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ROBO2 belongs to the ROBO family. Members of the ROBO family are a group of highly conserved transmembrane glycoproteins that make up a small subgroup of the immunoglobulin (Ig) superfamily. They are best known for their roles as receptors for the Slit family of repellent axon guidance cues. In structure, ROBOs are characterized by five C2-type Ig-like repeats, three fibronectin type III domains, a transmembrane region, and an intracellular domain with three (ROBO3) or four (ROBO1, 2) CC (conserved cytoplasmic) motifs. ROBO2 is a receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development. ROBO2 also abrogates SLIT-ROBO signaling in vitro.

References
  • Brose K, et al. (1999) Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96(6):795-806.
  • Brose K, et al. (1999) Slit2-Mediated chemorepulsion and collapse of developing forebrain axons. Neuron. 22(3):463-73.
  • Nagase T, et al. (2001) Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 7(4):273-81.
  • Size / Price
    Catalog: HG10310-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"