Quick Order

Human IFNA1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IFNA1 cDNA Clone Product Information
Gene_bank_ref_id:BC112300
RefSeq ORF Size:570bp
cDNA Description:Full length Clone DNA of Homo sapiens interferon, alpha 1 with C terminal Flag tag.
Gene Synonym:IFL, IFN, IFNA@, IFNA13, IFN-ALPHA, IFN-alphaD
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Mouse IFNA2 / Interferon alpha 2 ProteinRhesus IFNA2 / Interferon alpha 2 ProteinHuman IL29 / IFNL1 ProteinCynomolgus IFNAR2 / IFNABR Protein (ECD, His Tag)Human IFNA4 Protein (His Tag)Human Interferon alpha 2 / IFNA2 ProteinMouse IL-28B / IFN-lambda-3 Protein (His Tag)Rhesus IFNG / Interferon Gamma ProteinHuman IL-28B / IFN-lambda-3 Protein (His Tag)Human IFN-alpha / IFNA1 / IFN Protein (His Tag)Human Interferon alpha-B / IFNA8 Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (Fc Tag)Human IFNA5 / IFNaG / Interferon alpha-G Protein (Fc Tag)Human Interferon beta / IFN-beta / IFNB Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His & Fc Tag)Human Interferon omega-1 / IFNω / IFNW1 Protein (Fc Tag)Human IFNGR1 / CD119 Protein (His Tag)Mouse IFNAR1 / IFNAR Protein (His Tag)Human IFNAR2 / IFNABR Protein (Fc Tag)Human IFNAR2 / IFNABR Protein (His Tag)Human IFN-gamma / IFNG / γ-IFN ProteinHuman IFNL3 / IL28B / Interleukin-28B Protein (His Tag)Human IL-29 / Interleukin-29 Protein (His Tag)Mouse IFNGR2 Protein (His Tag)Mouse IFNG / Interferon Gamma Protein (Fc Tag)Mouse IFNG / Interferon Gamma Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (Fc Tag)Mouse IFNA4 / Interferon alpha-4 Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (Fc Tag)Mouse IFNGR1 / CD119 Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Human Interferon alpha 7 / IFNA7 Protein (Fc Tag)Human Interferon alpha 10 / IFNA10 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (His Tag)Human IFNα4 / IFNa4 / Interferon alpha-4 Protein (His Tag)Human IFNAR1 / IFNAR Protein (Fc Tag)Human IFNAR1 / IFNAR Protein (His Tag)Mouse IFNA2 / Interferon alpha 2 Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (Fc Tag)Rat IFNG / Interferon Gamma Protein (Fc Tag)Rat IFN-alpha / IFNA1 / IFN Protein (His Tag)Rat IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Human IFN omega 1 / IFNW1 Protein (His Tag)Rat IFNA5 / IFNaG Protein (His Tag)Human Interferon beta / IFN-beta / IFNB ProteinCynomolgus IFNA4 / IFNα4 / Interferon alpha-4 Protein (Fc Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (Fc Tag)Cynomolgus IFNA13 / Interferon alpha-13 Protein (Fc Tag)Rat IFNGR / IFNGR1 Protein (Fc Tag)Mouse IFNA5 / IFNaG Protein (Fc Tag)Mouse IFNG / Interferon Gamma ProteinCynomolgus IFNA13 / Interferon alpha-13 Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (His Tag)Mouse IFNB1 / IFN-beta / Interferon beta ProteinCynomolgus Interferon alpha-B / IFNA8 Protein (Fc Tag)Cynomolgus Interferon alpha-B / IFNA8 Protein (His Tag)Human Interferon alpha-B / IFNA8 ProteinFerret IFNG / Interferon Gamma Protein (His Tag)Cynomolgus IFNGR / IFNGR1 Protein (His Tag)Rhesus IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNA2 / Interferon alpha 2 Protein (His Tag)Mouse IFNA14 / Interferon alpha-14 Protein (His Tag)Rhesus IFNB1 / IFN-beta / Interferon beta Protein (Fc Tag)Rhesus IFNAR1 / IFNAR Protein (Fc Tag)Mouse IFNA13 / Interferon alpha-13 Protein (His Tag)Mouse IFNA4 / IFNα4 / Interferon alpha-4 Protein (His Tag)Rhesus IFNAR1 / IFNAR ProteinRhesus IFN gamma Protein (His Tag)
Background

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

References
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Size / Price
    Catalog: HG12341-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"