After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SerpinA5 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINA5 cDNA Clone Product Information
Gene_bank_ref_id:NM_000624.4
RefSeq ORF Size:1221bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 with N terminal Flag tag.
Gene Synonym:PCI, PAI3, PROCI, PLANH3
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Serpin A5, also well known as protein C inhibitor (PCI), is a member of the human serpin superfamily consists of at least 35 members. It is synthesized in the liver and has been detected in saliva, cerebral spinal fluid, amniotic fluid, tears and semen. As a potent inhibitor of the protein C anticoagulant pathway at the levels of both zymogen activation and enzyme inhibition, serpinA5 additionally inhibits a variety of serine protease including thrombin, factor Xa, several kallekreins and acrosin, and plays a role in the processes of blood coagulation and fertilization. Serpin A5 also inhibits urinary plasminogen activator (uPA), a mediator of tumor cell invasion, and regulates tumor growth and metastasis by inhibiting angiogenesis. Furthermore, recent studies have identified PCI as a potent and direct inhibitor of activated HGFA (hepatocyte growth factor activator), suggesting a novel function in the regulation of tissue repair and regeneration. Similar to serpins C1 and D1, the thrombin inhibitory activity of serpinA5 is enhanced by heparin.

References
  • Alireza, R. et al., 1995, J. Biol. Chem. 270: 25336-25339.
  • Silverman, G.A. et al., 2001, J. Biol. Chem. 276: 33293-33296.
  • Malleier, J.M. et al., 2007, Blood. 109: 4769-4776.
  • Asanuma, K. et al., 2007, Int. J. Cancer. 121: 955-965.
  • Hayashi, T. et al., 2007, J. Thromb. Haemost. 5: 1477-1485.
  • Size / Price
    Catalog: HG10309-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"