Quick Order

Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRSS8cDNA Clone Product Information
Gene_bank_ref_id:NM_002773.3
cDNA Size:1032
cDNA Description:ORF Clone of Homo sapiens protease, serine, 8 DNA.
Gene Synonym:CAP1, PROSTASIN
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10287-ACG$325
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10287-ACR$325
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10287-CF$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10287-CH$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10287-CM$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10287-CY$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone)HG10287-M$95
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10287-M-F$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10287-M-N$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10287-NF$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10287-NH$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10287-NM$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10287-NY$295
Human Prostasin / Prss8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10287-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Prostasin (Prss8), also known as channel activating protease 1 (CAP1), is a trypsinlike serine peptidase, and plays important roles in epithelial physiology. It is originally purified as an active, soluble enzyme from human seminal fluid and is highly expressed in prostate, lung, kidney, salivary gland and pancreas. Prostasin is expressed as a glycosyl-phosphatidylinositol (GPI)-anchored membrane protein in prostate epithelial cells, and also exists as a secreted proteolytic enzyme possibly via tryptic cleavage of its COOH-terminal hydrophobic domain. Prostasin is found to activate the epithelial sodium channel (ENaC) which is tightly regulated and is critical for maintaining salt and fluid balance in the lung and kidney in both normal and pathological conditions. Accordingly, prostasin has been proposed as a target for therapeutic inhibition in cystic fibrosis. In addition, prostasin inhibits prostate and breast cancer cell invasion in vitro, suggesting a functional role as a suppressor of tumor invasion, as well as a regulator of gene expression during inflammation.

Size / Price
Catalog:HG10287-NF
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"