Quick Order

Text Size:AAA

Mouse PARK7 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PARK7 cDNA Clone Product Information
Gene_bank_ref_id:NM_020569.3
RefSeq ORF Size:570bp
cDNA Description:Full length Clone DNA of Mus musculus Parkinson disease (autosomal recessive, early onset) 7.
Gene Synonym:Dj1, DJ-1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.

References
  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.
  • Size / Price
    Catalog: MG52768-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"