Quick Order

Text Size:AAA

Human RTN4 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RTN4 cDNA Clone Product Information
Gene_bank_ref_id:BC001035
RefSeq ORF Size:600bp
cDNA Description:Full length Clone DNA of Homo sapiens reticulon 4 with C terminal Flag tag.
Gene Synonym:ASY, NSP, NOGO, NOGOC, RTN-X, NOGO-A, NSP-CL, Nogo-B, Nogo-C, RTN4-A, RTN4-C, RTN4-B1, RTN4-B2, NI220/250, Nbla00271, RTN4Nbla10545
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Reticulon-4, also known as Foocen, Neurite outgrowth inhibitor, Nogo protein, Neuroendocrine-specific protein, Neuroendocrine-specific protein C homolog, RTN-x, Reticulon-5 and RTN4, is a multi-pass membrane protein which contains one reticulon domain. Isoform 1 of RTN4 is specifically expressed in brain and testis and weakly in heart and skeletal muscle. Isoform 2 of RTN4 is widely expressed except for the liver. Isoform 3 of RTN4 is expressed in brain, skeletal muscle and adipocytes. Isoform 4 of RTN4 is testis-specific. Reticulon-4 / RTN4 is a developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Reticulon-4 / RTN4 regulates neurite fasciculation, branching and extension in the developing nervous system. Reticulon-4 / RTN4 is involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. It regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 of RTN4 reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. Isoform 2 and isoform 3 of RTN4 inhibit BACE1 activity and amyloid precursor protein processing.

References
  • Yang J., et al., 2000, Cytogenet. Cell Genet. 88:101-102.
  • Prinjha R., et al., 2000, Nature 403: 383-384.
  • Tagami S., et al., 2000, Oncogene 19: 5736-5746.
  • Murayama K.S., et al., 2006, Eur. J. Neurosci. 24: 1237-1244.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Choudhary C., et al., 2009, Science 325: 834-840.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"