After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human S100A2 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A2 cDNA Clone Product Information
Gene_bank_ref_id:NM_005978.3
RefSeq ORF Size:294bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A2 with N terminal Flag tag.
Gene Synonym:S100A2, CAN19, S100L, MGC111539
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The calcium-binding Protein S100A2 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 family genes are located as a cluster on chromosome 1q21, and S100 proteins consisting of at least 20 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S100A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S100A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S100A2 gene have been implicated in certain carcinomas.

References
  • Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.
  • Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.
  • Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.
  • Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.
  • Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.
  • Size / Price
    Catalog: HG10180-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"