Quick Order

Human PI3 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PI3 cDNA Clone Product Information
Gene_bank_ref_id:BC010952
RefSeq ORF Size:354bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidase inhibitor 3, skin-derived with C terminal Flag tag.
Gene Synonym:ESI, WAP3, SKALP, WFDC14, cementoin, PI3
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Elafin, also known as Elastase-specific inhibitor, Peptidase inhibitor 3, Protease inhibitor WAP3, Skin-derived antileukoproteinase, WAP four-disulfide core domain protein 14, PI3, WAP3 and WFDC14, is a secreted protein which contains one WAP domain. Elafin / PI3 consists of two domains: the transglutaminase substrate domain (cementoin moiety) and the elastase inhibitor domain. The transglutaminase substrate domain at the N-terminus serves as an anchor to localize elafin covalently to specific sites on extracellular matrix proteins. The serine anti-protease Elafin / PI3 is expressed by monocytes, alveolar macrophages, neutrophils, and at mucosal surfaces and possesses antimicrobial activity. It is also known to reduce lipopolysaccharide-induced neutrophil influx into murine alveoli as well as to abrogate lipopolysaccharide-induced production of matrix metalloprotease 9, macrophage inhibitory protein 2, and tumor necrosis factor-alpha by as-yet unidentified mechanisms. Elafin / PI3 is a neutrophil serine protease inhibitor expressed in lung and displaying anti-inflammatory and anti-bacterial properties. Elafin / PI3 is a neutrophil and pancreatic elastase-specific inhibitor of skin. It may prevent elastase-mediated tissue proteolysis. Elafin / PI3 will regulate proteolytic enzymes during menstruation and will contribute to the innate defense against uterine infection.

Size / Price
Catalog: HG12187-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"