After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNDP2cDNA Clone Product Information
Gene_bank_ref_id:NM_018235.1
cDNA Size:1428
cDNA Description:ORF Clone of Homo sapiens CNDP dipeptidase 2 (metallopeptidase M20 family) DNA.
Gene Synonym:CNDP2, CN2, CPGL, PEPA, HsT2298, FLJ10830
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
 
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10168-ACG$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10168-ACR$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10168-ANG$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10168-ANR$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10168-CF$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10168-CH$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10168-CM$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10168-CY$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone)HG10168-M$95
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10168-M-N$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10168-NF$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10168-NH$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10168-NM$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10168-NY$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10168-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Mouse cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2, is a cytoplasm protein which belongs to the peptidase M20A family. CNDP2 / CPGL is a cytosolic enzyme that can hydrolyze carnosine to yield l-histidine and beta-alanine. CNDP2 / CPGL hydrolyzes a variety of dipeptides including L-carnosine but has a strong preference for Cys-Gly. It may be play a role as tumor suppressor in hepatocellular carcinoma (HCC) cells. Isoform 1 of CNDP2 / CPGL is ubiquitously expressed with higher levels in kidney and liver (at protein level). Isoform 2 of CNDP2 / CPGL is expressed in fetal tissues, it is only expressed in adult liver and placental tissues. CNDP2 / CPGL is highly expressed in the histaminergic neurons in the tuberomammillary nucleus, implying that it may supply histidine to histaminergic neurons for histamine synthesis.

References
  • Bakker,SJ. et al., 2008, Diabetes  57 (12):e16; author reply e17. 
  • Wanic, K. et al., 2008, Diabetes  57 (9): 2547-51.
  • McDonough,CW. et al., 2009, Hum Genet 126 (2): 265-75.
  • Kaur,H. et al., 2009, J Biol Chem. 284 (21):14493-502.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"